View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19327_low_2 (Length: 415)
Name: NF19327_low_2
Description: NF19327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19327_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 152 - 399
Target Start/End: Original strand, 909678 - 909921
Alignment:
| Q |
152 |
cagtaacactaagtttgaggaggatatcgtgacaattaatctcccgcatatattttcagtgaaatcttatgttttgagtttggttttatttggaatcgtt |
251 |
Q |
| |
|
|||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
909678 |
cagtaacagtaagttcgaggaggatattgtgacaattaatctcccgcatatattttcagtgaaatcttatgttttgagtttggttttatttggaattgtt |
909777 |
T |
 |
| Q |
252 |
tatgggaaaaggaatggtgaattctttcttatatatagaaacattggaaaatcttccattttctgtgagtttccttgatcacatccctcatcaacaaata |
351 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
909778 |
tatgggaaaaggaatggtgaattctttct----tatagaaacattggaaaatcttccattttctgtgagtttccttgatcacatccctcatcaacaaata |
909873 |
T |
 |
| Q |
352 |
ggaaactcaatgtaattaaccaaccaactaccgtaaaatcgttatgat |
399 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
909874 |
ggaaactcaatgtcattaaccaaccatctaccctaaaatctttatgat |
909921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University