View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19328_high_16 (Length: 222)
Name: NF19328_high_16
Description: NF19328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19328_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 102 - 206
Target Start/End: Complemental strand, 5525624 - 5525519
Alignment:
| Q |
102 |
tacataacaa-tccgatcatccaagagtccatttccagaccttgaacctcacatccaccgcacacttctcatctgccgtcgtcactttctcgccggcgac |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5525624 |
tacataacaaatccgatcatccaagagtccatttccagaccttgaacctcacatccaccgcacacttctcatccgccgtcgtcactttctcgccggcgac |
5525525 |
T |
 |
| Q |
201 |
atcgat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
5525524 |
atcgat |
5525519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 5525713 - 5525672
Alignment:
| Q |
11 |
aagaatattaattagtattaataataaaagcctctttgaaaa |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5525713 |
aagaaaattaattagtattaataataaaagcctctttgaaaa |
5525672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University