View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19328_low_10 (Length: 370)
Name: NF19328_low_10
Description: NF19328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19328_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 13840293 - 13840424
Alignment:
| Q |
18 |
tatcaaaacttgaaaaacattaagaacaagatctat--tgaataagaacaccacactagcatagtgcgactagaagtcactactgctcagttcgaattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
13840293 |
tatcaaaacttgaaaaacattaagaacaagatatatattgaataaacacaccacactagcatagtgagattagaagtcactactgctcagttcgaattca |
13840392 |
T |
|
| Q |
116 |
aacctattatattccagatgttgtagactatt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13840393 |
aacctattatattccagatgttgtagactatt |
13840424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 138
Target Start/End: Original strand, 3261545 - 3261617
Alignment:
| Q |
66 |
ccacactagcatagtgcgactagaagtcactactgctcagttcgaattcaaacctattatattccagatgttg |
138 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || ||||| ||||| || |||||||||||| |
|
|
| T |
3261545 |
ccacactagcatagtgaagtcagaagtcactactgctcagtttgagttcaagcctatcatgttccagatgttg |
3261617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University