View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19328_low_15 (Length: 242)
Name: NF19328_low_15
Description: NF19328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19328_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 39920612 - 39920850
Alignment:
| Q |
1 |
gaagcatcataagtgagatattttgtacgcatattcccattcttctaagaaatgttcaaggctcaacaaatcacaatgcaatttataagcgt--gaccta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
39920612 |
gaagcatcataagtgagatattttgtacgcatattcccattcttctaagaaatgttcaaggctcaacaaatcacaatgcaatttatgagcgtgagaccta |
39920711 |
T |
 |
| Q |
99 |
gttttgttcactat---atataaagttgtattaagtgatcatactttgtggattttacacaacgtagcagnnnnnnnnnnnnnnnnnnnggaagcaaaca |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39920712 |
gttttgttcactatataatataaagttgtattaagtgatcatactttgtggattttacacaacgtagcag-----cacaacacacaacaggaagcaaaca |
39920806 |
T |
 |
| Q |
196 |
tgacatgactaatggcaacagaaaacccatgtgatgatgtccat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
39920807 |
tgacatgactaatggcaacagaaaacccatgttatgttgtccat |
39920850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University