View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19329_high_7 (Length: 264)

Name: NF19329_high_7
Description: NF19329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19329_high_7
NF19329_high_7
[»] chr3 (1 HSPs)
chr3 (36-259)||(52410854-52411077)
[»] chr2 (1 HSPs)
chr2 (152-184)||(3476463-3476495)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 36 - 259
Target Start/End: Original strand, 52410854 - 52411077
Alignment:
36 atgaatgtgaattttctaatgtatcttaatatttggagtgtaaaattgattttgacatgattgatcactctcaaacataataattttgactccacgattg 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
52410854 atgaatgtgaattttctaatgtatcttaatatttggagtgtaaaattgattttgatatgattgatcactctcaaacataataattttgactccacgattg 52410953  T
136 attatgattgaagcagaaaattagagcttttgattttagaatttattttacatgccgatttattttatattaatgtattcgagcataaataattttacct 235  Q
    | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||    
52410954 actatgattgaagcaaaaaattagagcttttgattttagaatttattttacatgccgatttattttatattaatgtattcaaacataaataattttacct 52411053  T
236 tcatatcacttttaacaagaataa 259  Q
    ||||||||||||||||||||||||    
52411054 tcatatcacttttaacaagaataa 52411077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 3476495 - 3476463
Alignment:
152 aaaattagagcttttgattttagaatttatttt 184  Q
    ||||||||||||||||||| |||||||||||||    
3476495 aaaattagagcttttgattctagaatttatttt 3476463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University