View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19329_high_9 (Length: 220)
Name: NF19329_high_9
Description: NF19329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19329_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 205
Target Start/End: Complemental strand, 52410654 - 52410584
Alignment:
| Q |
135 |
ataagcgctatgcataaggttattcaatagctcggttgaatgcgatttcttaaccatatcaatattattat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52410654 |
ataagcgctatgcataaggttattcaatagctcggttgaatgtgatttcttaaccatatcaatattattat |
52410584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 52410781 - 52410719
Alignment:
| Q |
7 |
aaataaatcaaggaataataatactcagcagtagggtgaaacatgcatcttcatattttaaga |
69 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52410781 |
aaataaatcaaggaataataatgctcagcagtagtgtgaaacatgcatcttcatattttaaga |
52410719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University