View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19329_low_6 (Length: 400)
Name: NF19329_low_6
Description: NF19329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19329_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 54660406 - 54660154
Alignment:
| Q |
1 |
aagcaggacgaagctctttgctacagaactgattatactccaaagtatcacccttatctttcttcacctccaccaccagaaacgacggtgtcaccgcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660406 |
aagcaggacgaagctctttgctacagaactgattatactccaaagtatcacccttatctttcttcacctccaccaccagaaacgacggtgtcaccgcgta |
54660307 |
T |
|
| Q |
101 |
aatatccgctgcaatagccaactttcctttcctccctctttcttgcccttgaagtctcaccttcgtatcactactcttcacatcaaatttcaccgccttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660306 |
aatatccgctgcaatagccaactttcctttcctccctctttcttgcccttgaagtctcaccttcgtatcactactcttcacatcaaatttcaccgccttc |
54660207 |
T |
|
| Q |
201 |
gccacttgttccagtttcgatatcactctactcggcgtcccacccgttgcaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660206 |
gccacttgttccagtttcgatatcactctactcggcgtcccacccgttgcaaa |
54660154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 290 - 383
Target Start/End: Complemental strand, 54660117 - 54660024
Alignment:
| Q |
290 |
aaacaacggagacaaatcaaatccttctgatagtgaaattatatgaaaagcattcattgtcgtcgatgatttctcacactccataaattcaaac |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660117 |
aaacaacggagacaaatcaaatccttctgatagtgaaattatatgaaaagcattcattgtcgtcgatgatttctcacactccataaattcaaac |
54660024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University