View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19329_low_7 (Length: 365)
Name: NF19329_low_7
Description: NF19329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19329_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 15 - 324
Target Start/End: Complemental strand, 38684353 - 38684044
Alignment:
| Q |
15 |
catcatcattgtgtaagtgagatccaggttccattggtgtagaagcaggtttgctgcctagcacaccggaatcagacaagaggccaagacaatattgtcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38684353 |
catcatcattgtgtaagtgagatccaggttccattggtgtagaagcaggtttgctgcctagcacaccggaatcagacaagaggccaggacaatattgtcg |
38684254 |
T |
 |
| Q |
115 |
ttgacaaatggaaattcctgtgggagagtgagcaacctactcaacaaaaatttcaaaacaccaaggtctttaataccaaagtttactgtcaaggatttgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684253 |
ttgacaaatggaaattcctgtgggagagtgagcaacctactcaacaaaaatttcaaaacaccaaggtctttaataccaaagtttactgtcaaggatttgc |
38684154 |
T |
 |
| Q |
215 |
ttgagatgggtaagctctgccttatgatcacccacaaggacaatatcatctacataaatgagtaaagccatatacgaagatgaagttatgtgagtaaaaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684153 |
ttgagatgggtaagctctgccttatgatcacccacaaggacaatatcatctacataaatgagtaaagccatatacgaagatgaagttatgtgagtaaaaa |
38684054 |
T |
 |
| Q |
315 |
gagagtgatc |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
38684053 |
gagagtgatc |
38684044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University