View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19329_low_9 (Length: 264)
Name: NF19329_low_9
Description: NF19329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19329_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 36 - 259
Target Start/End: Original strand, 52410854 - 52411077
Alignment:
| Q |
36 |
atgaatgtgaattttctaatgtatcttaatatttggagtgtaaaattgattttgacatgattgatcactctcaaacataataattttgactccacgattg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52410854 |
atgaatgtgaattttctaatgtatcttaatatttggagtgtaaaattgattttgatatgattgatcactctcaaacataataattttgactccacgattg |
52410953 |
T |
|
| Q |
136 |
attatgattgaagcagaaaattagagcttttgattttagaatttattttacatgccgatttattttatattaatgtattcgagcataaataattttacct |
235 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
52410954 |
actatgattgaagcaaaaaattagagcttttgattttagaatttattttacatgccgatttattttatattaatgtattcaaacataaataattttacct |
52411053 |
T |
|
| Q |
236 |
tcatatcacttttaacaagaataa |
259 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52411054 |
tcatatcacttttaacaagaataa |
52411077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 3476495 - 3476463
Alignment:
| Q |
152 |
aaaattagagcttttgattttagaatttatttt |
184 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
3476495 |
aaaattagagcttttgattctagaatttatttt |
3476463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University