View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1932_high_15 (Length: 217)
Name: NF1932_high_15
Description: NF1932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1932_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 217
Target Start/End: Complemental strand, 46746965 - 46746773
Alignment:
| Q |
25 |
gttttgacatagtttgattaattgactcacgtatattcagagccatcagctaaataggcaccatagcttccaacagaagctgcaatcaaaatgggacggc |
124 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46746965 |
gttttgacatggtttgtttaatcgactcacgtatattcagagccatcagctaaataggcaccatagcttccaacagaagctgcaatcaaaatgggacggc |
46746866 |
T |
 |
| Q |
125 |
ttctatatctttcatctctgttgaagtcaaatgaatctttagtgcacctctcataatatatatcacgtgactcgcgagcaagctctacgcttc |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
46746865 |
ttctatatctttcatctctgatgaagtcaaatgaatctttagtgcacctatcataatatatatcacgtgcctcgcgcgcaagctctacgcttc |
46746773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University