View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1932_high_16 (Length: 213)
Name: NF1932_high_16
Description: NF1932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1932_high_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 48754578 - 48754790
Alignment:
| Q |
1 |
ctgcaggatttcagctgggactgacgagattttgactcgatttcattttgtatttgtttattgtggtgtgttatctctctgattgtggttacaaattaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48754578 |
ctgcaggatttcagctgggactgacgagattttgactcgatttcattttttatttgtttattgtggtgtgttgtctctctgattgtggttacaaattaga |
48754677 |
T |
|
| Q |
101 |
acagttaattgtctgaagctcaatatggggatcaaagccctgaaacaccttgaatgactcagaaaaggccatttaagaggttgcctctgatttccatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48754678 |
acagttaattgtctgaagctcaatatggggatcaaagccctgaaacaccttgaatgactcagaaaaggccatttaagaggttgcctctgatttccagttt |
48754777 |
T |
|
| Q |
201 |
cattttttgaaca |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48754778 |
cattttttgaaca |
48754790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University