View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1932_low_10 (Length: 320)
Name: NF1932_low_10
Description: NF1932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1932_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 8 - 304
Target Start/End: Complemental strand, 41274882 - 41274585
Alignment:
| Q |
8 |
aagcaaaggcacatgaagaagataagaaattgtacgcaagagagttggcctaactttgcacaaaggtaataattaataaagggacaaaatgtatgttatc |
107 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41274882 |
aagcaaaagcacatgaagaaaataagaaattgtacgcaagagagttggcctaactttgcacaaaggtaataattaataaagggacaaaatgtatgttatc |
41274783 |
T |
 |
| Q |
108 |
tcnnnnnnnnnnnnatggcatatctctgttttttctatctcccttcgggaatgcttgagaaagcaagggctgtctgtattcatttatatttctttgtgca |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41274782 |
tctttttcttttttatggcatatctctgttttttctatctcccttcgggaatgcttgagaaagcaagggctgtctgtattcatttatatttctttgtcca |
41274683 |
T |
 |
| Q |
208 |
tttgggacccta-tttctgtgatttaaatttagtcacgtttgttcattttgattagtagtaacttgtagttcatagatagataaaataaggttcttca |
304 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41274682 |
tttgggaccctattttctgtgatttaaatttagtcacgtttgttcattttgattagtagtaacttgtagttcatagatagataaaataaggttcttca |
41274585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University