View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1932_low_11 (Length: 281)
Name: NF1932_low_11
Description: NF1932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1932_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 33398112 - 33397844
Alignment:
| Q |
1 |
attcaaggtcttgctctttcatatttggagatttcgtttactctcccccaacacgagtttcaactcacagactccaaaaaagtcaaaatgaatannnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33398112 |
attcaaggtcttgctctttcatatttggagatttcgtttactctcccccaacacaagtttcaactcacagactcgaaaaaagtcaaaatgaatatttttt |
33398013 |
T |
|
| Q |
101 |
nnngtcgttcggaactatacctctagatgatttgatagtgtgatagactcaatcagtcaagtttctcttcatcaattcaagatgttacactccatggttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33398012 |
t--gtcgttcggaactatacctctagatgatttgatagtgtgatagactcaatcagtctagtttctcttcatcaattcaagatgttacattccatggttc |
33397915 |
T |
|
| Q |
201 |
tccttcttcgtttgtcaatgttattaatttgttagtatatttttggtatcataatggatttgttagaatta |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397914 |
tccttcttcgtttgtcaatgttattaatttgttagtatatttttggtatcataatggatttgttagaatta |
33397844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University