View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19330_high_27 (Length: 221)
Name: NF19330_high_27
Description: NF19330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19330_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 40276787 - 40276599
Alignment:
| Q |
19 |
gtaacgacagcaatgagaggagggtgtcgacgaaagggtactgtaatggtcgtgaagagttggatggtagtatcagagacaggtgaatcacgcgttgaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276787 |
gtaacgacagcaatgagaggagggtgtcgacgaaagggtactgtaatggtggtgaagagttggatggtagtatcagagacaggtgaatcacgcgttgaag |
40276688 |
T |
 |
| Q |
119 |
atattgacaaacactccatcatgcaacgaacagggttacctacgcgtgaccttagagctcttgatccaaaactctctaacccttcttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276687 |
atattgacaaacactccatcatgcaacgaacagggttacctacgcgtgaccttagagctcttgatccaaaactctctaacccttcttct |
40276599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 73 - 175
Target Start/End: Complemental strand, 39625453 - 39625351
Alignment:
| Q |
73 |
aagagttggatggtagtatcagagacaggtgaatcacgcgttgaagatattgacaaacactccatcatgcaacgaacagggttacctacgcgtgacctta |
172 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| || || ||||| ||||||||||||||||||| ||||||||| |||||| | |||||||||| |
|
|
| T |
39625453 |
aagagttggatggtagtatttgaaacaggtgaatcacgtgtcgaggatatcgacaaacactccatcatgcgacgaacaggtttacctgcacgtgacctta |
39625354 |
T |
 |
| Q |
173 |
gag |
175 |
Q |
| |
|
||| |
|
|
| T |
39625353 |
gag |
39625351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 73 - 175
Target Start/End: Complemental strand, 39635003 - 39634901
Alignment:
| Q |
73 |
aagagttggatggtagtatcagagacaggtgaatcacgcgttgaagatattgacaaacactccatcatgcaacgaacagggttacctacgcgtgacctta |
172 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| || || ||||| ||||||||||||||||||| ||||||||| |||||| | |||||||||| |
|
|
| T |
39635003 |
aagagttggatggtagtatttgaaacaggtgaatcacgtgtcgaggatatcgacaaacactccatcatgcgacgaacaggtttacctgcacgtgacctta |
39634904 |
T |
 |
| Q |
173 |
gag |
175 |
Q |
| |
|
||| |
|
|
| T |
39634903 |
gag |
39634901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University