View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19330_high_8 (Length: 417)
Name: NF19330_high_8
Description: NF19330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19330_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 8 - 398
Target Start/End: Original strand, 35043647 - 35044022
Alignment:
| Q |
8 |
ggtagataattctatcatcttttatgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgccggcagatagtgctc |
107 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35043647 |
ggtatataattctatcatcttttgtgcatgcttcaattatttttcaaaattattgggctggcccctgcatatgtgttttctctgctggcagatagtgctc |
35043746 |
T |
|
| Q |
108 |
ctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactccatttctaacaccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043747 |
ctccatcccttttatatacgttcaaatctacacctgcagagaaaccaacatcacacattacactacaccgctagctatagtactccatttctaacaccaa |
35043846 |
T |
|
| Q |
208 |
gcaaatgatgaataatttgctttcaccttcgacccttcaaccatttactatttgcaccactttgttgtttcttttcgttctcttttggctactgagaagc |
307 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043847 |
gcaaatgatgaataatttgctttcaccctcgacccttcaaccatttactatttgcaccactttgttgtttcttttcgttctcttttggctactgagaagc |
35043946 |
T |
|
| Q |
308 |
cgccgcattaatactagtgtagcttcaaagacaccaccaccagaagccagtggagcttggcctttgatcggccacctccacctcttaggtg |
398 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043947 |
cgccgcattaatactagtgtagct---------------ccagaagccggtggagcttggcctttgatcggccacctccacctcttaggtg |
35044022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 328 - 398
Target Start/End: Original strand, 35035791 - 35035861
Alignment:
| Q |
328 |
agcttcaaagacaccaccaccagaagccagtggagcttggcctttgatcggccacctccacctcttaggtg |
398 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35035791 |
agcttcaatgacaccaccacccgaagctgctggcgcttggcctttaatcggccacctccacctcttaggtg |
35035861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 398
Target Start/End: Original strand, 35029678 - 35029753
Alignment:
| Q |
329 |
gcttcaaagacaccaccacc------agaagccagtggagcttggcctttgatcggccacctccacctcttaggtg |
398 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| ||||| || || |||||||||||||||||||||| |
|
|
| T |
35029678 |
gcttcaaagacaccaccaccgccgccagaagccagcggagcatggccgttaattggccacctccacctcttaggtg |
35029753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 398
Target Start/End: Original strand, 35019594 - 35019662
Alignment:
| Q |
327 |
tagcttcaaagacaccaccaccagaagccagtggagcttggcctttgatcggccacctccacctcttaggtg |
398 |
Q |
| |
|
||||||||||||||||||| |||||| | ||| | ||||| || ||||||||||||||||||||||||| |
|
|
| T |
35019594 |
tagcttcaaagacaccaccg---gaagccggcggatcatggccgttaatcggccacctccacctcttaggtg |
35019662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University