View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19330_low_18 (Length: 309)
Name: NF19330_low_18
Description: NF19330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19330_low_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 101 - 309
Target Start/End: Original strand, 6684071 - 6684267
Alignment:
| Q |
101 |
aaattagactatggtaatgaagggcactggatatgggagtttctttcttcccataattaatttattaataattactaaaaaccgctcttgtaaggattta |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6684071 |
aaattaaactatggtaatgaagggcactggatatgggagtttctttcttcccataat------------aattactaaaaaccgctcttgtaaggattta |
6684158 |
T |
 |
| Q |
201 |
ccatctcaacatacaaaaacatcgttttgtcttgttttgaataatgcaatcacagggataaaagttatagcgatcaccaagaaagtaagcataataatat |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6684159 |
ccatctgaacatacaaaaacatcgttttgtcttgttttgaataatgaaatcacagggataaaagttatagtgatcaccaagaaagtaagcataataatat |
6684258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University