View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19330_low_19 (Length: 268)
Name: NF19330_low_19
Description: NF19330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19330_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 6498969 - 6498722
Alignment:
| Q |
1 |
caatagaattcggctccgccgtagaggcctcaatccaagctcgggctagagaccaaagagccctgaaactattgcaagaaagtaagaaatgtctaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||| ||||||| ||||||||||||| | | |
|
|
| T |
6498969 |
caatagaattcggctccgccgtagaggcctcaatccaagctcaggctagagatcaaagagccctgaaattattgtaagaaaggaagaaatgtctaact-a |
6498871 |
T |
 |
| Q |
101 |
ttcgacatcaccacaactgcagattgagtagtttgannnnnnnatcatcccgcatcctttggaacataatttacttgttgtatagattaaatgttgaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6498870 |
ttcgacatcaccacaactgcagattgagtagtttgatttttttataatcccgcatcctttgaaacataatttacttgttgtatagattaaatgttgaatc |
6498771 |
T |
 |
| Q |
201 |
acaagtggagctcaggggatcaccctcattgatccaagagcaaccacat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6498770 |
acaagtggagctcaggggatcaccctcattggtccaagagcaaccacat |
6498722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 2 - 79
Target Start/End: Original strand, 22403633 - 22403710
Alignment:
| Q |
2 |
aatagaattcggctccgccgtagaggcctcaatccaagctcgggctagagaccaaagagccctgaaactattgcaaga |
79 |
Q |
| |
|
|||| ||||||||||||| |||||| | |||||||||||||| ||| |||| | ||||||||||||| | ||||||| |
|
|
| T |
22403633 |
aatacaattcggctccgctgtagagactccaatccaagctcggactaaagactatagagccctgaaacaaatgcaaga |
22403710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 116
Target Start/End: Original strand, 45085200 - 45085314
Alignment:
| Q |
2 |
aatagaattcggctccgccgtagaggcctcaatccaagctcgggctagagaccaaagagccctgaaactattgcaagaaagtaagaaatgtctaattgat |
101 |
Q |
| |
|
||||||||| ||||| ||||||||| || |||||||||||||| |||||||||||||||||||||| | ||||||||| || || |||||||||| |||| |
|
|
| T |
45085200 |
aatagaatttggctctgccgtagagaccccaatccaagctcggactagagaccaaagagccctgaatcaattgcaagagaggaacaaatgtctaactgat |
45085299 |
T |
 |
| Q |
102 |
tcgacatcaccacaa |
116 |
Q |
| |
|
|| || || |||||| |
|
|
| T |
45085300 |
tcaacgtctccacaa |
45085314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 37943133 - 37943066
Alignment:
| Q |
1 |
caatagaattcggctccgccgtagaggcctcaatccaagctcgggctagagaccaaagagccctgaaac |
69 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37943133 |
caatagaattcggctccgccgtagaaacc-caatccaagctcggactagagaccaaagagccctaaaac |
37943066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University