View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19333_low_2 (Length: 461)
Name: NF19333_low_2
Description: NF19333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19333_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 4e-45; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 11895103 - 11894994
Alignment:
| Q |
19 |
ttacactcctcgaaagacgttagtggcacttgaatttaaaacttccacatcaatgtctatgttaattagaccaaactcttgaagacttcggagtttacta |
118 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11895103 |
ttacactcctcgaaagacgttactggaacttgaatttaaaacttccacatcaatgtctatgttaattagaccaaactcttgaagacttcggagtttac-- |
11895006 |
T |
 |
| Q |
119 |
tgtgtgaaccgt |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11895005 |
tgtgtgaaccgt |
11894994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 100 - 161
Target Start/End: Complemental strand, 11894988 - 11894927
Alignment:
| Q |
100 |
aagacttcggagtttactatgtgtgaaccgtataatatttgtattgtcatgtaatgactgac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
11894988 |
aagacttcggagtttactatgtgtgaaccgtatagtatttgtattgtaatgtaatgactgac |
11894927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 188
Target Start/End: Complemental strand, 11897097 - 11897043
Alignment:
| Q |
135 |
tatttgtattgtcatgt-aatgactgaccatattttttgttatcgaaacatgttt |
188 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
11897097 |
tatttgtattgtcatgtgaatgactgaccacattttgtattatcgaaacatgttt |
11897043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 395 - 446
Target Start/End: Complemental strand, 25417299 - 25417247
Alignment:
| Q |
395 |
tactcggagaataatgggttcgattccc-ggtggaacaacgcttggccagtgc |
446 |
Q |
| |
|
||||||| ||||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25417299 |
tactcggggaataccgggttcgattcccagggggaacaacgcttggccagtgc |
25417247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 402 - 446
Target Start/End: Original strand, 16450302 - 16450347
Alignment:
| Q |
402 |
agaataatgggttcgattccc-ggtggaacaacgcttggccagtgc |
446 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16450302 |
agaatattgggttcgattcccagggggaacaacgcttggccagtgc |
16450347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 395 - 439
Target Start/End: Original strand, 44945584 - 44945628
Alignment:
| Q |
395 |
tactcggagaataatgggttcgattcccggtggaacaacgcttgg |
439 |
Q |
| |
|
||||||||||||| |||||| ||||||| | |||||||||||||| |
|
|
| T |
44945584 |
tactcggagaatactgggtttgattcccagaggaacaacgcttgg |
44945628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University