View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_10 (Length: 426)
Name: NF19336_high_10
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 1 - 420
Target Start/End: Original strand, 6027949 - 6028368
Alignment:
| Q |
1 |
cctaacacagccatttctttcacaagctcaatcaattgatgtccttcaccttcaacatcactacaccttcttttcaaagccatccttgttatgatgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027949 |
cctaacacagccatttctttcacaagctcaatcaattgatgtccttcaccttcaacatcactgcaccttcttttcaaagccatccttgttatgatgttat |
6028048 |
T |
|
| Q |
101 |
tggaaagcatagtaagttcttcccctacattaacctcttttctcaagtcagctttctccatcataccctttaagaacaacgttatttcttcagctctaat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6028049 |
tagaaagcatagtaagttcttcccctacattaacctcttttctcaagtcagctttctccatcatgccctttaagaataacgttatttcttcagctctaat |
6028148 |
T |
|
| Q |
201 |
aggaaggtattgatgaagtatgcgtccgccgagaagttcggtcatgcaaagttttttcatgaatttccaataagttccataaggagccaaggcaaaatct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6028149 |
aggaaggtattgatgaagtatgcgtccgccgagaagttcggtcatgcaaagctttttcatgaacttccaataagttccataaggagccaaggcaaaatct |
6028248 |
T |
|
| Q |
301 |
gatgaaccatatgtgatgtattccaaattgctttgttttggtcggtttaagaaacaagtttcgtttgttttgaggcattgttttgccatttccggggaag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6028249 |
gatgaaccatatgtgatgtattccaaattgctttgttttggtcggtttaagaaacaagtttcgtttgttttgaggcattgttttgccatttccggggaag |
6028348 |
T |
|
| Q |
401 |
aaacaagaacacaaggtttg |
420 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6028349 |
aaacaagaacacaaggtttg |
6028368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University