View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_27 (Length: 249)
Name: NF19336_high_27
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 74 - 231
Target Start/End: Complemental strand, 32417191 - 32417032
Alignment:
| Q |
74 |
tctttctctttgatattgattc--gtttaatgtttgagttgccctaaaatcatgtccttgatataaagggttttctattcacaaagctaggaacaaactt |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32417191 |
tctttctctttgatattgattcttgtttaatgtttgagttggcctaaaatcatgtccttgatataaagcgttttctattcacaaagctaggaacaaactt |
32417092 |
T |
|
| Q |
172 |
gaaggactttgtgctttcaccatgtcaccacctatgactagctctgagtaaggaaccttc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417091 |
gaaggactttgtgctttcaccatgtcaccacctatgactagctctgagtaaggaaccttc |
32417032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 50
Target Start/End: Complemental strand, 32417209 - 32417179
Alignment:
| Q |
20 |
atgaccagcaacttcacctctttctctttga |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32417209 |
atgaccagcaacttcacctctttctctttga |
32417179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University