View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19336_high_30 (Length: 232)

Name: NF19336_high_30
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19336_high_30
NF19336_high_30
[»] chr2 (1 HSPs)
chr2 (14-217)||(41905138-41905337)


Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 41905337 - 41905138
Alignment:
14 gcataggaaggtgggtcatgtggtcatacatatatagtgacagatatgttactaaggaaacagaaagtttctatttaacttttgtaggttaggtggctga 113  Q
    ||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41905337 gcataggaaggtgggtcatgtggtcatacata----gtgacagatatgttactaaggaaacagaaagtttctatttaacttttgtaggttaggtggctga 41905242  T
114 tttattttaaaagtagcaaatttcaaaggatggttgattcaaagtataaaagttgaactcaatgcaatatgattggtatcaaactaacagtacatagaat 213  Q
    ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41905241 tttattttaaaagtagcaaatttcaaaagatgattgattcaaagtataaaagttgaactcaatgcaatatgattggtatcaaactaacagtacatagaat 41905142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University