View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_30 (Length: 232)
Name: NF19336_high_30
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 41905337 - 41905138
Alignment:
| Q |
14 |
gcataggaaggtgggtcatgtggtcatacatatatagtgacagatatgttactaaggaaacagaaagtttctatttaacttttgtaggttaggtggctga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41905337 |
gcataggaaggtgggtcatgtggtcatacata----gtgacagatatgttactaaggaaacagaaagtttctatttaacttttgtaggttaggtggctga |
41905242 |
T |
|
| Q |
114 |
tttattttaaaagtagcaaatttcaaaggatggttgattcaaagtataaaagttgaactcaatgcaatatgattggtatcaaactaacagtacatagaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41905241 |
tttattttaaaagtagcaaatttcaaaagatgattgattcaaagtataaaagttgaactcaatgcaatatgattggtatcaaactaacagtacatagaat |
41905142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University