View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_31 (Length: 223)
Name: NF19336_high_31
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 5374717 - 5374908
Alignment:
| Q |
14 |
agatgaaacaacagaatcaaaatcagctagagatgatgatggacatggaagtcacacattaacaacagcagcaggttctgttgtagcagaagctagctta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374717 |
agatgaaacaacagaatcaaaatcagctagagatgatgatggacatggaagtcacacattaacaacagcagcaggttctgttgtagcagaagctagctta |
5374816 |
T |
|
| Q |
114 |
tttggtttagcttctggtacagcaagaggcatggctactgaagcccgtgtcgcggcttacaaggtgtgctggcttagtggttgtttcacttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374817 |
tttggtttagcttctggtacagcaagaggcatggctactgaagcgcgtgtcgcagcttacaaggtgtgctggcttagtggttgtttcacttc |
5374908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 196
Target Start/End: Complemental strand, 47367844 - 47367675
Alignment:
| Q |
27 |
gaatcaaaatcagctagagatgatgatggacatggaagtcacacattaacaacagcagcaggttctgttgtagcagaagctagcttatttggtttagctt |
126 |
Q |
| |
|
|||||||| ||| | || |||||||| || |||||||||||||| | ||| |||||||||||||||| || |||| ||| ||| | || ||||| |||| |
|
|
| T |
47367844 |
gaatcaaagtcaccaagggatgatgacgggcatggaagtcacacctcaactacagcagcaggttctgcagttgcaggagcaagcctcttcggttttgctt |
47367745 |
T |
|
| Q |
127 |
ctggtacagcaagaggcatggctactgaagcccgtgtcgcggcttacaaggtgtgctggcttagtggttg |
196 |
Q |
| |
|
|||| ||||||| |||||||||||| |||| || || || |||||||| ||||| |||||| ||||||| |
|
|
| T |
47367744 |
ctgggacagcaaaaggcatggctacacaagctcgagtggccgcttacaaagtgtgttggcttggtggttg |
47367675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University