View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_34 (Length: 210)
Name: NF19336_high_34
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 44814176 - 44813997
Alignment:
| Q |
16 |
atatacaacatataataatgatatactcaagattgcagtagtcaaaggcctagtaatctacagtcacatttaactcttagattgcacaannnnnnnaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44814176 |
atatacaacatataataatgatatactcaagattgcagtagtcaaaggcctagtaatctacagtcacatttaactcttagattgcacaatttttttaata |
44814077 |
T |
|
| Q |
116 |
caaaggacgggagcatgactctattgaaaccttgcagcacgttttatagaaattttgaaattttagccaaatggaattat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44814076 |
caaaggacgggagcatgactctattgaaaccttgcagcacgttttatagaaattttgaaattttagccaaatggaattat |
44813997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University