View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_high_35 (Length: 206)
Name: NF19336_high_35
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 29555675 - 29555731
Alignment:
| Q |
132 |
caatttgcaaaacatagtcgttcatgtgttattgacttttgagtgtttggttttcatt |
189 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29555675 |
caatttgcaaaacatag-cgttcatgtgttattgacttttgagtgtttggttttcatt |
29555731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 29555611 - 29555667
Alignment:
| Q |
24 |
tacacatgcaatttgatgagattattaattttcacattatcataaaaatatttttgt |
80 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29555611 |
tacatatgcaatttgatgagattattaatttcgacattatcataaaaatatttttgt |
29555667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University