View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_low_1 (Length: 758)
Name: NF19336_low_1
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 41519411 - 41519468
Alignment:
| Q |
13 |
tcatcaagagcatcactatcatctaaccacttttcctttaacttctttaactccaaaa |
70 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
41519411 |
tcatcaagagcattactatcatctaaccacttttccttcaacttctccaactccaaaa |
41519468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 41509191 - 41509248
Alignment:
| Q |
13 |
tcatcaagagcatcactatcatctaaccacttttcctttaacttctttaactccaaaa |
70 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
41509191 |
tcattaagagcagtactatcatctagccacttttccttcaacttctccaactccaaaa |
41509248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 324 - 369
Target Start/End: Original strand, 17349264 - 17349309
Alignment:
| Q |
324 |
tagtttttacttggtctttaagcccattttaagctcgcgtgacccc |
369 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17349264 |
tagtttttgcttggtctttaagcccattttaagctcgcgtgacccc |
17349309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University