View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_low_27 (Length: 272)
Name: NF19336_low_27
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 80 - 265
Target Start/End: Complemental strand, 51844353 - 51844168
Alignment:
| Q |
80 |
gtgatatcttttgggtcattatcaaaccatttccacccctcttgaataaagcatgcggtctctctatcaccacaaaacttagatcagacggaggagatcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51844353 |
gtgatatcttttgggtcattatcaaaccatttccacccctcttgaataaagcatgcggtctctctatcaccacagaacttagatcagacggaggagatcc |
51844254 |
T |
|
| Q |
180 |
tggtacgtcgtttactaacccaaaaaatataactttgtaccctttttccatccaagttctatatttatcttcaacatttcttctct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844253 |
tggtacgtcgtttactaacccaaaaaatataactttgtaccctttttccatccaagttctatatttatcttcaacatttcttctct |
51844168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 153
Target Start/End: Original strand, 51844670 - 51844736
Alignment:
| Q |
87 |
cttttgggtcattatcaaaccatttccacccctcttgaataaagcatgcggtctctctatcaccaca |
153 |
Q |
| |
|
||||| ||| || |||||||||||| || ||||||||||| ||| ||| |||||||| ||||||||| |
|
|
| T |
51844670 |
ctttttggtaatcatcaaaccattttcatccctcttgaatgaagtatgtggtctctcaatcaccaca |
51844736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 16559891 - 16559740
Alignment:
| Q |
16 |
actgtgatatctcttccatccaagattgtcaagttgagagttttttcgacgagagtttcaagaagtgatatcttttgggtcattatcaaaccatttccac |
115 |
Q |
| |
|
|||||||||| || ||||||||| |||| | ||||||||| || | || |||| ||| |||||||||||||||| ||||||||||||| | ||||| |
|
|
| T |
16559891 |
actgtgatatgtcgaccatccaaggttgttatgttgagagtcttaccaacaagagcttccagaagtgatatcttttcggtcattatcaaatcttttccgt |
16559792 |
T |
|
| Q |
116 |
ccctcttgaataaagcatgcggtctctctatcaccacaaaacttagatcaga |
167 |
Q |
| |
|
|||||||||||| || ||| |||||||| ||||||||||| ||| |||||| |
|
|
| T |
16559791 |
ccctcttgaatataggatgtggtctctcattcaccacaaaaattacatcaga |
16559740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 41 - 142
Target Start/End: Original strand, 1412279 - 1412380
Alignment:
| Q |
41 |
ttgtcaagttgagagttttttcgacgagagtttcaagaagtgatatcttttgggtcattatcaaaccatttccacccctcttgaataaagcatgcggtct |
140 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||| |||||||| | ||||||||||||| ||||| || |||| ||||||||||| | ||||| |
|
|
| T |
1412279 |
ttgtcaagtagagagtcttttcgacgagagcttcaagaaatgatatctactaggtcattatcaaatcattttcatccctaatgaataaagcaagtggtct |
1412378 |
T |
|
| Q |
141 |
ct |
142 |
Q |
| |
|
|| |
|
|
| T |
1412379 |
ct |
1412380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 1411926 - 1411857
Alignment:
| Q |
18 |
tgtgatatctcttccatccaagattgtcaagttgagagttttttcgacgagagtttcaagaagtgatatc |
87 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||| ||||| ||| | |||||||||||| |||||||||| |
|
|
| T |
1411926 |
tgtgatatctctttcatccaaaattttcaagttaagagtctttccttcgagagtttcaataagtgatatc |
1411857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University