View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19336_low_28 (Length: 269)
Name: NF19336_low_28
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19336_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 254
Target Start/End: Complemental strand, 29959468 - 29959243
Alignment:
| Q |
29 |
tggaaaagtaatttgttcctcctcctttcttttccccctttccacgggttaaaattcctccccccttggtatggttggtaccaaacattgagctaaaatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959468 |
tggaaaagtaatttgttcctcctcctttcttttccccctttccacgggttaaaattcctccccccttggtatggttggtaccaaacattgagctaaaatt |
29959369 |
T |
 |
| Q |
129 |
agggtagaaacgatgnnnnnnnatccttaacatgagcatggtgttgtccaaatatagatcgtaaaactagtcatgtcaaattccttgtactctctttcac |
228 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959368 |
agggtagaaactatgtttttttatccttaacatgagcatggtgttgtccaaatatagatcgtaaaactagtcatgtcaaattccttgtactctctttcac |
29959269 |
T |
 |
| Q |
229 |
gtgtgggatcattgagagtgaaatgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29959268 |
gtgtgggatcattgagagtgaaatgt |
29959243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University