View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19336_low_36 (Length: 210)

Name: NF19336_low_36
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19336_low_36
NF19336_low_36
[»] chr7 (1 HSPs)
chr7 (16-195)||(44813997-44814176)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 44814176 - 44813997
Alignment:
16 atatacaacatataataatgatatactcaagattgcagtagtcaaaggcctagtaatctacagtcacatttaactcttagattgcacaannnnnnnaata 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||    
44814176 atatacaacatataataatgatatactcaagattgcagtagtcaaaggcctagtaatctacagtcacatttaactcttagattgcacaatttttttaata 44814077  T
116 caaaggacgggagcatgactctattgaaaccttgcagcacgttttatagaaattttgaaattttagccaaatggaattat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44814076 caaaggacgggagcatgactctattgaaaccttgcagcacgttttatagaaattttgaaattttagccaaatggaattat 44813997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University