View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19336_low_37 (Length: 206)

Name: NF19336_low_37
Description: NF19336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19336_low_37
NF19336_low_37
[»] chr4 (2 HSPs)
chr4 (132-189)||(29555675-29555731)
chr4 (24-80)||(29555611-29555667)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 29555675 - 29555731
Alignment:
132 caatttgcaaaacatagtcgttcatgtgttattgacttttgagtgtttggttttcatt 189  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
29555675 caatttgcaaaacatag-cgttcatgtgttattgacttttgagtgtttggttttcatt 29555731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 29555611 - 29555667
Alignment:
24 tacacatgcaatttgatgagattattaattttcacattatcataaaaatatttttgt 80  Q
    |||| ||||||||||||||||||||||||||  ||||||||||||||||||||||||    
29555611 tacatatgcaatttgatgagattattaatttcgacattatcataaaaatatttttgt 29555667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University