View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_high_10 (Length: 392)
Name: NF19337_high_10
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 31853038 - 31853241
Alignment:
| Q |
9 |
gaagaaaataacctcagaatcaaagtggtgtggtgaaacaaaagcatgtcctttagcttctaaaatggtcaaaccataattctcaaagtttctgagcagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31853038 |
gaagaaaataacctcagaatcaaagtggtgtggtgaaacaaaagcatgtcctttagcttctaaaatggtcaaaccataattctcaaagtttctaagcagc |
31853137 |
T |
 |
| Q |
109 |
tttgatttttgatcaaacatgtttagagccataactctaccatcatctgtttctattttggtttcaaaatctctgtcttcaaaaacataaggattttcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853138 |
tttgatttttgatcaaacatgtttagagccataactctaccatcatctgtatctattttggtttcaaaatctctgtcttcaaaaacataaggattttcat |
31853237 |
T |
 |
| Q |
209 |
cctc |
212 |
Q |
| |
|
|||| |
|
|
| T |
31853238 |
cctc |
31853241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 271 - 377
Target Start/End: Original strand, 31853306 - 31853412
Alignment:
| Q |
271 |
tctcgctcttgcttcatccgatgatagtcctcacacttgtccatgcatattcgcttatcctcttcatcatattggcgttgttgtttgcattggtgtatac |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853306 |
tctcgctcttgcttcatccgatgatagtcctcacacttgtccatgcatattcccttatcctcttcatcatattggcgttgttgtttgcattggtgtatac |
31853405 |
T |
 |
| Q |
371 |
aagtttt |
377 |
Q |
| |
|
||||||| |
|
|
| T |
31853406 |
aagtttt |
31853412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University