View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_high_15 (Length: 277)
Name: NF19337_high_15
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_high_15 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 10 - 261
Target Start/End: Complemental strand, 19906 - 19655
Alignment:
| Q |
10 |
aagaatatgtgaagaagttccaaatccatacactactttttatgattatgtgcaggacatggttcagcaacagcagaagggaataaaggagatttgtttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19906 |
aagaatatgtgaagaagttccaaatccatacactactttttatgattatgtgcaggacatggttcagcaacagcagaagggaataaaggagatttgtttt |
19807 |
T |
 |
| Q |
110 |
gttggtccaatatggcatactcctcaaccacaatattgcacaatctttcctgtgctaccaaaacaagaaactgatttgctccaggtacttattccataca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19806 |
gttggtccaatatggcatactcctcaaccacaatattgcacaatctttcctgtgctaccaaaacaagaaactgatttgctccaggtacttattccataca |
19707 |
T |
 |
| Q |
210 |
aaatcaatccatgctttcttgtcctactattattactttactacttgctttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19706 |
aaatcaatccatgctttcttgtcctactattattactttactacttgctttt |
19655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University