View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_high_24 (Length: 217)
Name: NF19337_high_24
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 40448229 - 40448049
Alignment:
| Q |
16 |
tcatcaaccaatcaagcataaatgcagaaattgttggtagtttagagagtaacttagagaggccttcaaaattactcaaaactactactactacttgtag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40448229 |
tcatcaaccaatcaagcataaatgcagaaattgttggtagtttagagagtaacttagagaggccttcaaaattactcaaaactactactact---tgtag |
40448133 |
T |
|
| Q |
116 |
ttcaagctatatgaaaacagaacatctctcacaaaaaacagcttcatatgttttttcgtttgaaaacgagaatccaccaccaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40448132 |
ttcaagctatatgaaaacagaacatctctcacaaaaaacagcttcatatgttttttcgtttgaaaacgagaatccaccaccaag |
40448049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University