View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_high_26 (Length: 203)
Name: NF19337_high_26
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 19 - 178
Target Start/End: Complemental strand, 32638332 - 32638169
Alignment:
| Q |
19 |
aaagtaggagttgtgttagagcttttgcatcccccat-------tcaccaaaggtaatgaatgatattgggacctatgaatatttgtaaaacataacaat |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32638332 |
aaagtagtagttgtgttagagcttttgcatcccccataattcattcaccaaaggtaatgaatgatattgggacctatgaatatttgtaaaacataaaaat |
32638233 |
T |
 |
| Q |
112 |
catcatgaccactattaataatccacatgatatttgtaaaaggcctcgtgaatatgcttttaattta |
178 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32638232 |
catcatgaccactat---taatccacatgatatttgtaaaaggcctcgtgaatatgcttttaattta |
32638169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University