View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_low_13 (Length: 325)
Name: NF19337_low_13
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 168 - 319
Target Start/End: Complemental strand, 10268183 - 10268037
Alignment:
| Q |
168 |
aaaatggaatttattttaaagtgatgagattcaaattgatttcattcaataaagtaatcatcattaaattaaattaaatgttcgaaaagagtgtttccca |
267 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
10268183 |
aaaatggatttcattttaaagtgatgagattcaaattgatttcattcaataaagtaatcatcattaaattaaat-----gttggaaaagagtgtttccca |
10268089 |
T |
|
| Q |
268 |
tttctaccttccatatgatagatagcttgtttaaatccataccctttgcttc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10268088 |
tttctaccttccatatgatagatagcttgtttaaatccataccctctgcttc |
10268037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 10268422 - 10268338
Alignment:
| Q |
20 |
attaactcgagatctgtaaacgtgctcattcccgagatctcaagttcgattcagattcaagttggatgaggtcctttagtttctt |
104 |
Q |
| |
|
||||||| ||||||||| |||||||| ||| |||||||||| ||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
10268422 |
attaacttgagatctgtgcacgtgctccttctcgagatctcaggttcgattcagattcaagttggatgaggtaatttaatttctt |
10268338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University