View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_low_16 (Length: 266)
Name: NF19337_low_16
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 831574 - 831814
Alignment:
| Q |
9 |
gaataatatagaaaaactgaactgagccatttcgattgattccaaaccaaagtgaactgtgtaattggtttggtgcaccatggttttggttctcaaaccg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
831574 |
gaatagtatagaaaaactgaactgagccatttcgattgattccaaaccaaagtgaactgtgtaattggtttggtgcaccatggttttggttctcaaaccg |
831673 |
T |
 |
| Q |
109 |
aactgttttagattagtgtaatctgaactgctattcttattaagaactaaactgtttctgagatacagttttcaaagtaattttgttattcaaacaacca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
831674 |
aactgttttagattagtgtaatctgaactgctattcttattaagaactaaactgtttctgagatacagttttcaaagtaattttgttattcaaacaacca |
831773 |
T |
 |
| Q |
209 |
gaaaaaggtttttaaagttattgtttcaagcatgctgattt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
831774 |
gaaaaaggtttttaaagttattgtttcaagcatgctgattt |
831814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University