View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_low_17 (Length: 255)
Name: NF19337_low_17
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 43831013 - 43830858
Alignment:
| Q |
7 |
gaagcaaaggaaattacatgtcctaataaatctttcttcattgtctcttgtagtactaatcctcagaaatcaaataacagtgttaaacttctcgtctaac |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43831013 |
gaagcaaaggaaattaaatgtcctaataaatctttcttcattgtctcttgtagtactaatcctcagaaatcaaataacagtgttaaacttctcgtctaac |
43830914 |
T |
 |
| Q |
107 |
ataatcattttgtatacaatgatagactgactaattttaagatcactcatctcatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43830913 |
ataatcattttgtatacaatgatagactgactaattttaagatcactcatctcatg |
43830858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University