View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19337_low_20 (Length: 250)
Name: NF19337_low_20
Description: NF19337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19337_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 51 - 250
Target Start/End: Original strand, 40447801 - 40448000
Alignment:
| Q |
51 |
tcaaatgtgtataaattgaaaaatgaacctttttgaggtttggaatatgggatgaaagagctatgaatagttggctaatcttttccctccttattctctc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447801 |
tcaaatgtgtataaattgaaaaatgaacctttttgaggtttggaataagggctgaaagagctatgaatagttggctaatcttttccctccttattctctc |
40447900 |
T |
|
| Q |
151 |
agcaattatatgatctggtgtgtgatgagttgttgtagatttagaaaatgaaccgttcttcttgttgctctcatgattctttacacgtcgtggtccattc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
40447901 |
agcaattatatgatctggtgtgtgatgagttgttgtagatttagaaaatgaaccgttcttcttgttgctctcattattctttacacgtcgtggaccattc |
40448000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University