View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19338_low_11 (Length: 208)
Name: NF19338_low_11
Description: NF19338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19338_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 14432302 - 14432123
Alignment:
| Q |
15 |
catagggcatgattttcttgacactttcagtgtcggcacttagacacaagacacttttcttctttgcactttatgtgctttccattggtgaaggaggcca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14432302 |
catagggcatgattttcttgacactttcagtgtcggcacttagacacaagacacttttcttctttgcactttatgtgctttccattggtgaaggaggtca |
14432203 |
T |
|
| Q |
115 |
taagccttgtgtgcaaactttcgccgccgatcagttcgacgacgacacacctgaagagaaggatgctaagagttcatttt |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
14432202 |
taagccttgtgttcaaactttcgccgccgatcagttcgacgacgacacgcccgaagagaaggatgctaagagttcatttt |
14432123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University