View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19339_low_7 (Length: 335)
Name: NF19339_low_7
Description: NF19339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19339_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 31 - 329
Target Start/End: Complemental strand, 48154238 - 48153940
Alignment:
| Q |
31 |
tccaactcaccctcttcatcttctctatccatggacatagacgaatccatagaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttca |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154238 |
tccaactcaccctcttcatcttctctatccatggacatagacgaatccacagaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttca |
48154139 |
T |
|
| Q |
131 |
cccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttcaccatcggcgttcatcccaccgttatccaattggatgacaacgagatccc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154138 |
cccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttcaccatcggcgttcatcccaccgttatccaattggatgacaacgagatccc |
48154039 |
T |
|
| Q |
231 |
cgccgtccccaccacctccgatcactctctcactccggctgctttcatcggcggtatctgcatcggtggcttggagtcccttgttgctcttcatctcac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48154038 |
cgccgtccccaccacctccgatcactctctcactcccgctgctttcatcggcggtatctgcatcggtggcttggagtcccttgttgctcttcatgtcac |
48153940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 81 - 228
Target Start/End: Original strand, 4109283 - 4109427
Alignment:
| Q |
81 |
agaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctcttc |
180 |
Q |
| |
|
|||||| || ||| |||| |||||||||||||| || || ||||||||||| || ||||| | |||||||||| |||||||||| ||| || |||| | |
|
|
| T |
4109283 |
agaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctctt---gctgcatgtgtcatgtcatgaagaagcttctctcc |
4109379 |
T |
|
| Q |
181 |
accatcggcgttcatcccaccgttatccaattggatgacaacgagatc |
228 |
Q |
| |
|
||||| || ||| |||||||||| ||| |||| || |||||||||||| |
|
|
| T |
4109380 |
accataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
4109427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University