View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1933_high_6 (Length: 294)
Name: NF1933_high_6
Description: NF1933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1933_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 45090120 - 45089895
Alignment:
| Q |
17 |
actatcaagtccagcttctcaacatcatcatcatatacctctttgagagcttcaataacctcttcatcatctgttaaatcttcccacttactaattggga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090120 |
actatcaagtccagcttctcaacatcatcatcatatacctctttgagagcttcattaacctcttcatcatctgttaaatcttcccacttactaattggga |
45090021 |
T |
 |
| Q |
117 |
tcattagcatgtttcttctgaattcattatatctcgctactcccctttctctatctctataaactagtaaacaaaatattcatcattttagaacaagttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45090020 |
tcattagcatgtttcttctgaattcattatatctcgctactcccctttctctatctctataaactagtaaacaaaatattcatcattttataacaagttg |
45089921 |
T |
 |
| Q |
217 |
atcatataaaattattacaaaaccat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45089920 |
atcatataaaattattacaaaaccat |
45089895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 242 - 286
Target Start/End: Complemental strand, 45089875 - 45089831
Alignment:
| Q |
242 |
taccttccatagtagccatgtcaactggatcaggtctttcttctc |
286 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45089875 |
taccttccatagtagctatgtcaactggatcaggtctttcttctc |
45089831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University