View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1933_low_7 (Length: 273)
Name: NF1933_low_7
Description: NF1933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1933_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 40469487 - 40469723
Alignment:
| Q |
13 |
aaaatagtgaaaaaggatagagacnnnnnnnagggaaaaaatggttagagacttggtatttaagaaaaactaattaactaacttaaaacacttgccattc |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40469487 |
aaaatagtgaaaaaggatagagactttttttagggaaaaaatggttagagacttcgtatttaagaaaaactaattaactta-----aacacttgccattc |
40469581 |
T |
 |
| Q |
113 |
catcaactgatttgtgctagaaagatcgatcttaggagaggttaatgtaattttctctaatgatcaatgataatagcataaaagttattgaaggacaata |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40469582 |
catcaactgatttgtgctcgaaagatcgatcttaggagaggttaatgtaattttctctaatgatcaatgataatagcataaaagttattgaaggacaata |
40469681 |
T |
 |
| Q |
213 |
gtggcagtgttatcagaatagtatacgaagttacaaaccaac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40469682 |
gtggcagtgttatcagaatagtatacgaagttacaaaccaac |
40469723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University