View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19340_low_11 (Length: 231)
Name: NF19340_low_11
Description: NF19340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19340_low_11 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 44 - 212
Target Start/End: Complemental strand, 53848 - 53680
Alignment:
| Q |
44 |
atgatcagagagatagagatataaaatagtcgggagagatgcaaaaagttgatccaatctctttggcgagctaccctcaacaaaaaaggtctatcattcc |
143 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53848 |
atgattagagagatagagatataaaatagtcgggagagatgcaaaaagttgatccaatctctttggcgagctaccctcaacaaaaaaggtctatcatccc |
53749 |
T |
 |
| Q |
144 |
ctcagcaaacaaaacatgttttcttatatgattcaacaaattaaaatttgttgaatcatagttaaaaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53748 |
ctcagcaaacaaaacatgttttcttatatgattcaacaaattaaaatttgttgaatcatagttaaaaat |
53680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University