View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19342_high_10 (Length: 298)
Name: NF19342_high_10
Description: NF19342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19342_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 103 - 243
Target Start/End: Complemental strand, 29324935 - 29324795
Alignment:
| Q |
103 |
aagtatggatgattgatggatacgtttggtactgataatcacacactacattaattcctttttcggtgcttttcctatttcgcttatcaacgtcatcttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29324935 |
aagtatggatgattgatggatacgtttggtactgataatcacacactacattaattcctttttcggtgcttttcctatttcgcttatcaacgtcatcttg |
29324836 |
T |
|
| Q |
203 |
cctttcctacttcgcttattaaatatatgaatcacaaaaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29324835 |
cctttcctacttcgcttattaaatatatgaatcacaaaaaa |
29324795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 105 - 178
Target Start/End: Original strand, 52193358 - 52193437
Alignment:
| Q |
105 |
gtatggatgattgatggata---cgtttggtactgataatcacacacta---cattaattcctttttcggtgcttttcct |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
52193358 |
gtatggatgattgatggatatgtcgtttggtactgataatcacccactactacattaattcctttttcggtgcttttcct |
52193437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University