View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19343_low_4 (Length: 322)
Name: NF19343_low_4
Description: NF19343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19343_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 33967015 - 33967196
Alignment:
| Q |
1 |
atgctgaaaatgtaatgcatgtttgacattcttaagagaagattgtgaaaatgaaaaaatgatggagaatggtatgttttagtttggtttatatatacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33967015 |
atgctgaaaatgtaatgcatgtttgacattcttaagagaagattgtgaaaatgaaaaaatgatggagaatggtatgttttggtttggtttatatatacta |
33967114 |
T |
|
| Q |
101 |
gttatgtttccaaaatgcgcgtaatcgtaggttttggtttcgaattcagtcatagaactgcaataagattaaaactctaaac |
182 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33967115 |
gttatgtttccaaaatgcgcgtaatcataggttttggtttcgaattcagtcatagaactgcaataagattaaaactctaaac |
33967196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 165 - 306
Target Start/End: Original strand, 33967212 - 33967353
Alignment:
| Q |
165 |
aagattaaaactctaaacaaaatatttggtcatatattatggtcctatccgactcgagagattagtctgtgtgattgtgcgctgaggatatgtaggttac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33967212 |
aagattaaaactctaaacaaaatatttggtcatatattatggtcttatctaactcgagagattagtctgtgtgattgtgcgctgaggatatgtaggttac |
33967311 |
T |
|
| Q |
265 |
attatagtagtaatgtttatggtacttatttttggttgaaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33967312 |
attatagtagtaatgtttatggtacttatttttggttgaaaa |
33967353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 232
Target Start/End: Complemental strand, 10413232 - 10413204
Alignment:
| Q |
204 |
tggtcctatccgactcgagagattagtct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10413232 |
tggtcctatccgactcgagagattagtct |
10413204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University