View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19343_low_5 (Length: 271)

Name: NF19343_low_5
Description: NF19343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19343_low_5
NF19343_low_5
[»] chr1 (1 HSPs)
chr1 (1-235)||(28240971-28241205)


Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28240971 - 28241205
Alignment:
1 tagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatgtgttcagtcccac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28240971 tagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatgtgttcagtcccac 28241070  T
101 gattgatttgggattgttcaaagaattgaagagaggacaaaaagttttgatacctctcatattaactatgttcttagagaggctgacgaaattgcagata 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28241071 gattgatttgggattgttcaaagaattgaagagaggacaaaaagttctgatacctctcatattaactatgttcttagagaggctgacgaaattgcagata 28241170  T
201 gtcttgcaaagtttggcctttctctaacttgtaga 235  Q
    |||||||||||||||||||||||||||||||||||    
28241171 gtcttgcaaagtttggcctttctctaacttgtaga 28241205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University