View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19344_high_4 (Length: 280)
Name: NF19344_high_4
Description: NF19344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19344_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 22564417 - 22564677
Alignment:
| Q |
10 |
atttcatatcaatgaaaagggcatttac---cctttaacgtgtaggactcnnnnnnnacctaagtacatgttgatgtggggggaaaagattgctgacatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22564417 |
atttcatatcaatgaaaagggcatttactaccctttaacgtgtaggactctttttttacctaagtacatgttgatgtgggggaaaaagattgctgacatt |
22564516 |
T |
|
| Q |
107 |
ttgttgtacacccaagttgtatcaagcttgattttaacttcaataacaaaaccttactaatttagggtggtgaatttgaatgaactttgttaaaagagga |
206 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22564517 |
ttgttgtacacccaagttgtatccagcttgattttaacttcaataacaaaaccttgctaatttagggtggtgaatttgaatgaactttgttaaaataggt |
22564616 |
T |
|
| Q |
207 |
atttgagcaaagatattttagggcattttggtc---aaaattataagatagtgctggtttc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
22564617 |
atttgagcaaagatattttagggcattttggtcaaaaaaattaaaagatagtgctggtttc |
22564677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University