View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19345_low_2 (Length: 326)
Name: NF19345_low_2
Description: NF19345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19345_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 279834 - 279528
Alignment:
| Q |
18 |
agaatgagtacatcatccaatgaaattcatgtaatttggtaaatatactcctaaaagaacaagagagcgtgtatattacttttttgattataatttccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279834 |
agaatgagtacatcatccaatgaaattcatgtaatttggtaaatatactcctaaaagaacaagagagcgtgtatattacttttttgattataatttccac |
279735 |
T |
 |
| Q |
118 |
gtaatgcttatacaaagaatcaagaaaccaactcaatttg--atctcattatttagaagtaaaggtttgctttgtaatcaatttcatatatgctaagaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279734 |
gtaatgcttatacaaagaatcaagaaaccaactcaatttgatatctcattatttagaagtaaaggtttgctttgtaatcaatttcatatatgctaagaat |
279635 |
T |
 |
| Q |
216 |
taaatagaaaacagc-nnnnnnntcagaaaaatggaatggaactcgggtctcttaaagtgctgcattctcttttattggtatgttgttatgcatatcctt |
314 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279634 |
taaatagaaaacagcaaaaaaaatcacaaaaatggaatggaactcgggtctcttaaagtgctgcattctcttttattggtatgttgttatgcatatcctt |
279535 |
T |
 |
| Q |
315 |
tgctact |
321 |
Q |
| |
|
|| |||| |
|
|
| T |
279534 |
tgttact |
279528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University