View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19346_low_17 (Length: 256)
Name: NF19346_low_17
Description: NF19346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19346_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 14 - 240
Target Start/End: Complemental strand, 44976690 - 44976461
Alignment:
| Q |
14 |
actcaaagtgacatgttgattccatgcaatgcaacattcaacccaaaaaatgagcaagttcacggga---caccacaaatgaagaacccgtgaacacaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44976690 |
actcaaagtgacatgttgattccatgcaatgcaacattcaacccaaaaaatgagcaagttcacgggagtacaccacaaatgaagaacccgtgaacacaaa |
44976591 |
T |
|
| Q |
111 |
cattatatagctcagacatagcagacaagagatggatcagctgcaagcaacttagccaagtgacaaaatcactttcataatgaatgaggatgacagcttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44976590 |
cattatatagctcagacatagcagacaagagatggatcagctgcaagcaacttagccaagtgacaaaatcactttcataatgaatgaggatgacagcttt |
44976491 |
T |
|
| Q |
211 |
ggattcttccctcacttttgctactataac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44976490 |
ggattcttccctcacttttgctactataac |
44976461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University