View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19347_low_3 (Length: 393)
Name: NF19347_low_3
Description: NF19347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19347_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 270 - 390
Target Start/End: Original strand, 30723113 - 30723233
Alignment:
| Q |
270 |
attaatattgataattgttcgtgtttgaaaatgcagaaaaatagttctaggaaaactgttatacaaatggagtctgttggttcaactcacaagaagcata |
369 |
Q |
| |
|
||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | |||||||||| |
|
|
| T |
30723113 |
attaatattgatacttggtagtgtttgaaaatgcagaaaaatagttctaggaaaactgttaaacaaatggagtctgttggttcaagtaataagaagcata |
30723212 |
T |
 |
| Q |
370 |
aggcaaaagaggatataatca |
390 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
30723213 |
aggcaaacgaggatataatca |
30723233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 307 - 345
Target Start/End: Original strand, 30715072 - 30715110
Alignment:
| Q |
307 |
aaaatagttctaggaaaactgttatacaaatggagtctg |
345 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30715072 |
aaaatagttctaggaaaactgctatacaaatggagtctg |
30715110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University