View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19348_low_6 (Length: 231)
Name: NF19348_low_6
Description: NF19348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19348_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 216
Target Start/End: Complemental strand, 2530975 - 2530774
Alignment:
| Q |
15 |
tcaatcactacaaaaataaacagataacatatccaaaacatttatcacattagccacaaaactatacctaagaaagagaaccctatttgcttgatttctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2530975 |
tcaatcactacaaaaataaacagataacatatccaaaacatttatcacattagccacaaaactatacctaagaaagagaaccctatgtgcttgatttctt |
2530876 |
T |
 |
| Q |
115 |
cttgagttcctgcattgtcaatctagtctgctccctaaccacctcagcgcgattcaaaaacacatccatctcggcagcctgcaacttcttccacctctcc |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530875 |
cttgagttcctgcattgccaatctagtctgctccctaaccacctcagcgcgattcaaaaacacatccatctcggcagcctgcaacttcttccacctctcc |
2530776 |
T |
 |
| Q |
215 |
tc |
216 |
Q |
| |
|
|| |
|
|
| T |
2530775 |
tc |
2530774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University